View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_low_25 (Length: 326)
Name: NF0235_low_25
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 137 - 193
Target Start/End: Complemental strand, 3418152 - 3418096
Alignment:
| Q |
137 |
agtagctatgttgttactactttgatttgagcggcaaatattgcagaattaaaatcc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3418152 |
agtagctatgttgttactactttgatttgagcggcaaatattgcagaattaaaatcc |
3418096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 202 - 245
Target Start/End: Complemental strand, 3418110 - 3418067
Alignment:
| Q |
202 |
gcagaattaaaatcctgaaaacagcgagacctcttcatctcatt |
245 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| ||||| |
|
|
| T |
3418110 |
gcagaattaaaatcctgaaaacagcaaaacctcttcatgtcatt |
3418067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1617 times since January 2019
Visitors: 2392