View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_low_26 (Length: 314)
Name: NF0235_low_26
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 79 - 303
Target Start/End: Complemental strand, 7184206 - 7183983
Alignment:
| Q |
79 |
tactcgtggtagatctggtgatatctccttggggttcagtcgaacctttcaccatctttcccaaacttcttatcgcggggattctagaatctgcttttcg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
7184206 |
tactcgtggtagatctggtgatatctccttggggttcagtcgaacctttcaccatctttcccaaacttcttatcgcggggattctaga-tcttcttttcg |
7184108 |
T |
|
| Q |
179 |
ctccgggatgtcattgctttgccgaccttttgcatctcttcgtactgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtctt |
278 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7184107 |
ctccgggatgtcattgctttgtcgaccttttgcatctcttcgtactgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtctt |
7184008 |
T |
|
| Q |
279 |
ttctgatgttatccacgaacttcat |
303 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7184007 |
ttctgatgttatccacgaacttcat |
7183983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1397 times since January 2019
Visitors: 2391