View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_low_32 (Length: 252)
Name: NF0235_low_32
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 36328531 - 36328311
Alignment:
| Q |
12 |
atgagataaataataggcggccacgtatataatatcgtaacaaattaagtgtagtttgtttaatttgttaccattaattttagggatagtttgttccacg |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36328531 |
atgagataaataataggcggccacgtgtataatatcgtaacaaattaagtatagtttgtttaatttgttaccattaattttagggatagtttgttccacg |
36328432 |
T |
 |
| Q |
112 |
catatactttaaattgacctaaatcgtgcccaagtttctccattcactattctctcnnnnnnnaagttggtg---------gtgagtgacaacaatcctt |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
36328431 |
catatactttaaattgacaaaaatcgtgcccaagtttctgcattcactattctctctttttttaagttggtggtgttatacgtgagcgacaacaatcctt |
36328332 |
T |
 |
| Q |
203 |
ttcaaagtttatcgataattt |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36328331 |
ttcaaagtttatcgataattt |
36328311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University