View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_low_37 (Length: 227)
Name: NF0235_low_37
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_low_37 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 37318208 - 37318417
Alignment:
| Q |
7 |
gtagtggccagcaagggagggggaattggagttggggagtcacatgaaggagaaagataaggaggttatttgtgggggcaaaatatgggttgttggaagg |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37318208 |
gtagtggccagcaagggaggaggaattggagttggggagtcacatgaaggagaaagataaggaggttatttgtgggggcaaaatatgggttgttggaagg |
37318307 |
T |
|
| Q |
107 |
t-nnnnnnngtgcggtgcactcctcatatctcatatgtaattttagataatgtttggtggagtacacttcatatggatttgtacacttt--gagagagag |
203 |
Q |
| |
|
| ||||||| || ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37318308 |
taaaaaaaagtgcggtaca-------------atatggaattttagaaaatgtttggtggagtacacttcatatggatttgtacactttgagagagagag |
37318394 |
T |
|
| Q |
204 |
aaaaaatttacatgaatttgaacc |
227 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
37318395 |
aaaaaatttacatg-atttgaacc |
37318417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1585 times since January 2019
Visitors: 2392