View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_low_38 (Length: 211)
Name: NF0235_low_38
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 29104898 - 29105039
Alignment:
| Q |
1 |
aaaactctttttggagcctcttcatagcgatttgcattaggttttgtgcatggatgagtttcggagacgatggttcgagctcgagtaacgagtgcatggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104898 |
aaaactctttttggagcctcttcatagcgatttgcattaggttttgagcatggatgagtttcggagacgatggttcgagctcgagtaacgagtgcatggc |
29104997 |
T |
|
| Q |
101 |
tctttgaagttggtgaacgtggtgaatatactgaatggcttc |
142 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29104998 |
tctttgaagttggttaacgtggtgaatatactgaatggcttc |
29105039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 6 - 143
Target Start/End: Original strand, 29090642 - 29090779
Alignment:
| Q |
6 |
tctttttggagcctcttcatagcgatttgcattaggttttgtgcatggatgagtttcggagacgatggttcgagctcgagtaacgagtgcatggctcttt |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29090642 |
tctttttggagcctcttcatagcaatttgcattaggttttgtgcgtggatgagttctggagacgatggttcgagctcgagtaacgagtgcatggctcttt |
29090741 |
T |
|
| Q |
106 |
gaagttggtgaacgtggtgaatatactgaatggcttca |
143 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
29090742 |
gaagttggttaacgtggtgaatgtactgaatggcttca |
29090779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2599 times since January 2019
Visitors: 2402