View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_high_34 (Length: 237)
Name: NF0238_high_34
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 141 - 213
Target Start/End: Complemental strand, 46931727 - 46931655
Alignment:
| Q |
141 |
aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgataatgatttctgcagctcagcca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46931727 |
aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca |
46931655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 188
Target Start/End: Complemental strand, 44510360 - 44510317
Alignment:
| Q |
145 |
tatcatcccaaaccaatcctgatgaaccttgtctcctgaatgat |
188 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
44510360 |
tatcatcccaaacaaaccctgatgaaccttgtcttctgaatgat |
44510317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University