View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_high_35 (Length: 233)
Name: NF0238_high_35
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 188
Target Start/End: Complemental strand, 44845457 - 44845289
Alignment:
| Q |
20 |
tagcataggctgccatttgagtctgatccgaatactgaaccccacaaaacttgtctgaatcgttacatgttgtactgttgtcgcgacagacacaaccgca |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44845457 |
tagcacaggctgccatttgagtctgatccgaatactgaaccccacaaagcttgtctgaatcgttacatgttgtactgttgtcgcgacagacacaaccgca |
44845358 |
T |
|
| Q |
120 |
tttggattcgggttgagtcagttgatgattgaccaaactttgaagggaaataagcaagacagaaagaat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44845357 |
tttggattcgggttgagtcagttgatgattgaccaaactttgaagggaaataagcaagacagaaagaat |
44845289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 92
Target Start/End: Complemental strand, 44858410 - 44858354
Alignment:
| Q |
36 |
ttgagtctgatccgaatactgaaccccacaaaacttgtctgaatcgttacatgttgt |
92 |
Q |
| |
|
|||| |||||| |||||||| |||||||||| ||| || ||||||||||||||||| |
|
|
| T |
44858410 |
ttgattctgattagaatactggaccccacaaaccttctccgaatcgttacatgttgt |
44858354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2774 times since January 2019
Visitors: 2404