View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0238_high_37 (Length: 228)

Name: NF0238_high_37
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0238_high_37
NF0238_high_37
[»] chr8 (1 HSPs)
chr8 (50-172)||(11027972-11028094)
[»] chr1 (1 HSPs)
chr1 (167-204)||(8293547-8293584)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 50 - 172
Target Start/End: Complemental strand, 11028094 - 11027972
Alignment:
50 aatgcaaatgttaataattaattgttagattaaataaagtggttcttattttattttttgggttcaatggaaataacttgttttactgccatccatgcca 149  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11028094 aatgcaaatgttaatagttaattgttagattaaataaagtggttcttattttattttttgggttcaatggaaataacttgttttactgccatccatgcca 11027995  T
150 gttataattttagaaagtaccag 172  Q
    |||||||||||||||||||||||    
11027994 gttataattttagaaagtaccag 11027972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 8293584 - 8293547
Alignment:
167 taccagtttcaatcaattgtaagcagctccacaggttc 204  Q
    ||||||||||| ||||||||||||||||||||||||||    
8293584 taccagtttcagtcaattgtaagcagctccacaggttc 8293547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1902 times since January 2019
Visitors: 2394