View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_high_49 (Length: 208)
Name: NF0238_high_49
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_high_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 25 - 97
Target Start/End: Complemental strand, 46931727 - 46931655
Alignment:
| Q |
25 |
aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46931727 |
aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca |
46931655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 131 - 201
Target Start/End: Complemental strand, 46931627 - 46931557
Alignment:
| Q |
131 |
atgatatgatatggttgaatatttgaaggaaaattctaaattccaactaattattatatttatgatgatgt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46931627 |
atgatatgatatggttgaatatttgaaggaaaattctaaattccaactaattattatatatatgatgatgt |
46931557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 29 - 72
Target Start/End: Complemental strand, 44510360 - 44510317
Alignment:
| Q |
29 |
tatcatcccaaaccaatcctgatgaaccttgtctcctgaatgat |
72 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
44510360 |
tatcatcccaaacaaaccctgatgaaccttgtcttctgaatgat |
44510317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2764 times since January 2019
Visitors: 2404