View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0238_high_50 (Length: 208)

Name: NF0238_high_50
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0238_high_50
NF0238_high_50
[»] chr8 (1 HSPs)
chr8 (19-143)||(11027970-11028094)


Alignment Details
Target: chr8 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 19 - 143
Target Start/End: Original strand, 11027970 - 11028094
Alignment:
19 atctggtactttctaaaattataactggcatggatggcagtaaaacaagttatttccattgaacccaaaaaataaaataagaaccactttatttaatcta 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11027970 atctggtactttctaaaattataactggcatggatggcagtaaaacaagttatttccattgaacccaaaaaataaaataagaaccactttatttaatcta 11028069  T
119 acaattaattattaacatttgcatt 143  Q
    |||||||| ||||||||||||||||    
11028070 acaattaactattaacatttgcatt 11028094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2343 times since January 2019
Visitors: 2400