View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0238_low_17 (Length: 337)

Name: NF0238_low_17
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0238_low_17
NF0238_low_17
[»] chr1 (1 HSPs)
chr1 (80-261)||(38678148-38678329)


Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 80 - 261
Target Start/End: Complemental strand, 38678329 - 38678148
Alignment:
80 atgccaattatgaatgataattctataaagttactcataatttctcttcaccatacaaatttaactacttatattgatctatatgaaattgtttaaataa 179  Q
    ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
38678329 atgccaactataaatgataattctataaagttactcataatttctcttcaccatacaaatttaactacttgtattgatctatatgaaattgtttaaataa 38678230  T
180 cttcaatatgcgacggagtgacaactctagcttcgttaactatgaattttgaaggagtattttttgaactaagagcataaac 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38678229 cttcaatatgcgacggagtgacaactctagcttcgttaactatgaattttgaaggagtattttttgaactaagagcataaac 38678148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University