View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_17 (Length: 337)
Name: NF0238_low_17
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0238_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 80 - 261
Target Start/End: Complemental strand, 38678329 - 38678148
Alignment:
Q |
80 |
atgccaattatgaatgataattctataaagttactcataatttctcttcaccatacaaatttaactacttatattgatctatatgaaattgtttaaataa |
179 |
Q |
|
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
38678329 |
atgccaactataaatgataattctataaagttactcataatttctcttcaccatacaaatttaactacttgtattgatctatatgaaattgtttaaataa |
38678230 |
T |
 |
Q |
180 |
cttcaatatgcgacggagtgacaactctagcttcgttaactatgaattttgaaggagtattttttgaactaagagcataaac |
261 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38678229 |
cttcaatatgcgacggagtgacaactctagcttcgttaactatgaattttgaaggagtattttttgaactaagagcataaac |
38678148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1866 times since January 2019
Visitors: 2394