View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_21 (Length: 318)
Name: NF0238_low_21
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 7 - 270
Target Start/End: Original strand, 418540 - 418803
Alignment:
| Q |
7 |
tggttggctgttgccaaggtgttaatggggtttcttgttgccaaactgcaagttttgagcaaaacaaagtggaaaccgataaaaagcaggggagcaaagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
418540 |
tggttggctgttgccaaggtgttaatggggtttcttgttgccaaactgcaagttttgagcaaaacaaagtggaaaccgataaaaagcaggggagcaaagt |
418639 |
T |
 |
| Q |
107 |
atgtgggagttggcctatattacaaaaacgcgatattcttgcagctaccggtattgttggcgctttagcagctgttgccattggttacagattttataga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
418640 |
ctgtgggagttggcctatattacaaaaacgcgatattcttgcagctaccggtattgttggcgctttagcagctgttgccattggttacagattttataga |
418739 |
T |
 |
| Q |
207 |
aggtcaggctgagagcttgagggttctatagtttttacaattttaatcaagaaataataatagt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
418740 |
aggtcaggctgagagcttgagggttctatagtttttacaattttaatcaagaaataataatagt |
418803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 397974 - 397902
Alignment:
| Q |
9 |
gttggctgttgccaaggtgttaatggggt---ttcttgttgccaaactgcaagttttgagcaaaacaaagtgg |
78 |
Q |
| |
|
||||| ||||| ||||||||| ||||||| |||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
397974 |
gttggttgttgtcaaggtgttgatggggtggtttcttgttgcaaaagtcaaagttttgagcaaaacaaagtgg |
397902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 9 - 49
Target Start/End: Original strand, 406193 - 406233
Alignment:
| Q |
9 |
gttggctgttgccaaggtgttaatggggtttcttgttgcca |
49 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
406193 |
gttggttgttgccaaggtgttgatggggtttcttgtggcca |
406233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University