View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0238_low_31 (Length: 290)

Name: NF0238_low_31
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0238_low_31
NF0238_low_31
[»] chr3 (2 HSPs)
chr3 (216-286)||(8140028-8140098)
chr3 (216-253)||(8163927-8163964)
[»] chr4 (1 HSPs)
chr4 (36-204)||(16160802-16160971)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 8140028 - 8140098
Alignment:
216 tgttgctcataacttgatactttctcatgctgctgcagtcagagtatacaaaagaaaatatcaggtaattg 286  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
8140028 tgttgctcataacttgatactttctcatgctgctgcagtcagagtatacaagagaaaatatcaggtaattg 8140098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 253
Target Start/End: Original strand, 8163927 - 8163964
Alignment:
216 tgttgctcataacttgatactttctcatgctgctgcag 253  Q
    |||||||||| |||| ||||||||||||||||||||||    
8163927 tgttgctcatcactttatactttctcatgctgctgcag 8163964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 36 - 204
Target Start/End: Original strand, 16160802 - 16160971
Alignment:
36 aatatggaaggattaggaaaacttgaatgcaaggctttgttgccgaattgtctaagttatctgttgtaataaatgatgcattagttcatcaat-gaacca 134  Q
    |||||||||||||||| ||   ||||| |||  | || |||| |||| ||||| |||||||  ||||| |||  | ||||||||| ||||||| ||||||    
16160802 aatatggaaggattagaaagggttgaacgcagtggttggttgtcgaactgtctgagttatcgtttgtagtaatggctgcattagtgcatcaattgaacca 16160901  T
135 ttgagtctatgtctgttgttgttttcttaatttcagttggggatgttgcctccctcttatgttgtgcctt 204  Q
    ||| |||||||| ||||||||||| ||| ||||   |||| ||||| | |||||||||||||||| ||||    
16160902 ttgtgtctatgtttgttgttgtttgcttcattttgtttggagatgtggactccctcttatgttgttcctt 16160971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2104 times since January 2019
Visitors: 2396