View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_31 (Length: 290)
Name: NF0238_low_31
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0238_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 8140028 - 8140098
Alignment:
Q |
216 |
tgttgctcataacttgatactttctcatgctgctgcagtcagagtatacaaaagaaaatatcaggtaattg |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
8140028 |
tgttgctcataacttgatactttctcatgctgctgcagtcagagtatacaagagaaaatatcaggtaattg |
8140098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 253
Target Start/End: Original strand, 8163927 - 8163964
Alignment:
Q |
216 |
tgttgctcataacttgatactttctcatgctgctgcag |
253 |
Q |
|
|
|||||||||| |||| |||||||||||||||||||||| |
|
|
T |
8163927 |
tgttgctcatcactttatactttctcatgctgctgcag |
8163964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 36 - 204
Target Start/End: Original strand, 16160802 - 16160971
Alignment:
Q |
36 |
aatatggaaggattaggaaaacttgaatgcaaggctttgttgccgaattgtctaagttatctgttgtaataaatgatgcattagttcatcaat-gaacca |
134 |
Q |
|
|
|||||||||||||||| || ||||| ||| | || |||| |||| ||||| ||||||| ||||| ||| | ||||||||| ||||||| |||||| |
|
|
T |
16160802 |
aatatggaaggattagaaagggttgaacgcagtggttggttgtcgaactgtctgagttatcgtttgtagtaatggctgcattagtgcatcaattgaacca |
16160901 |
T |
 |
Q |
135 |
ttgagtctatgtctgttgttgttttcttaatttcagttggggatgttgcctccctcttatgttgtgcctt |
204 |
Q |
|
|
||| |||||||| ||||||||||| ||| |||| |||| ||||| | |||||||||||||||| |||| |
|
|
T |
16160902 |
ttgtgtctatgtttgttgttgtttgcttcattttgtttggagatgtggactccctcttatgttgttcctt |
16160971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2104 times since January 2019
Visitors: 2396