View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_32 (Length: 286)
Name: NF0238_low_32
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 35 - 133
Target Start/End: Complemental strand, 10806826 - 10806728
Alignment:
| Q |
35 |
taagtatttgattcgtaccaaaaacataataaaaaatgtaagaacaagtgaaatctttggataattttggactctgatatacaagattaacaaacacaa |
133 |
Q |
| |
|
||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10806826 |
taagtatttgactcataccaaaaacatagtaaaaaatgtaagaacaagtgaaatctttggataatttcggactctgatatacaagattaacaaacacaa |
10806728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 173 - 250
Target Start/End: Complemental strand, 10806742 - 10806665
Alignment:
| Q |
173 |
gattaacaaacacaaaatgttaatgctaatacaaagttaaatcgttgtggaggtatttacttttcttttaaatcttct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10806742 |
gattaacaaacacaaaatgttaatgctaatacaaagttaaatcgttgtggaggtatttacttttcttttaaatcttct |
10806665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University