View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_36 (Length: 265)
Name: NF0238_low_36
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_low_36 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 2 - 265
Target Start/End: Complemental strand, 47594261 - 47593998
Alignment:
| Q |
2 |
aaaaaactactaataattaaaaacaaaagtatatatttaatgaaaatgaactaacctactgtcgaggataaaattcacttatagacacctcgttgacaga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47594261 |
aaaaaactactaataattaaaaacaaaagtatatatttaatgaaaatgaactaacctactgtcgaggataaaattcacttatagacacctcgttgacaga |
47594162 |
T |
|
| Q |
102 |
aaatgatacaaaattattcacagaacttgatttctgtgctgcaatatcttgattcgttctatcgtgtaggaaaaatgctggttcttgtggggatgacaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47594161 |
aaatgatacaaaattattcacagaacttgatttctgtgctgcaatatcttgattcgttctatcgtgtaggaaaaatgctggttcttgtggggatgacaat |
47594062 |
T |
|
| Q |
202 |
tctggtgaatgactattaagatatgaaacaaccgttgccattgtaggtcttatatttggatttt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47594061 |
tctggtgaatgactattaagatatgaaacaaccgttgccattgtaggtcttacatttggatttt |
47593998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 265
Target Start/End: Complemental strand, 47619974 - 47619883
Alignment:
| Q |
174 |
aaatgctggttcttgtggggatgacaattctggtgaatgactattaagatatgaaacaaccgttgccattgtaggtcttatatttggatttt |
265 |
Q |
| |
|
|||||||||||||||||| ||| || ||| |||| ||| || ||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
47619974 |
aaatgctggttcttgtggaaatggcagttcaagtgagtgattagtaagatatgaaacgactgttgccattgtaggtctagcatttggatttt |
47619883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2517 times since January 2019
Visitors: 2401