View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_40 (Length: 253)
Name: NF0238_low_40
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0238_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 37065741 - 37065552
Alignment:
Q |
1 |
tgagtgttacttcaaaggggagtttaggacgtgttcaaatttgggtggttgtggcagcttagttggcaatttattattatatggcacgtggaaaatttaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37065741 |
tgagtgttacttcaaaggggagtttaggacgtgttcaaatttgggtggttgtggcagcttagttggcaatttattattatatggcacgtggaaaatttaa |
37065642 |
T |
 |
Q |
101 |
cctagaagttttttgtatagtgtgtgaattattacatccatctagataccattttaagttgatataaacgaaactagacttctatctctt |
190 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
37065641 |
cctagaagttttttgtatagtgtgtgaattattacatccatctagataccaatttaagttgatataaacgaaactagacttctatctctt |
37065552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University