View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_47 (Length: 231)
Name: NF0238_low_47
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_low_47 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 84 - 231
Target Start/End: Complemental strand, 10663730 - 10663583
Alignment:
| Q |
84 |
agaaagagtggacttatatcttaattatgaattgttcaaatgaaaatattggacttaataatgaacatctaaccacttatgataatgacttaattaatat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10663730 |
agaaagagtggacttatatcttaattatgaattgttcaaatgaaattattggacttaataatgaacatctaaccacttatgataatgacttaattaatat |
10663631 |
T |
 |
| Q |
184 |
tctgagtaatttggatactcatgcatgtcagaagtatggtgaataaac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10663630 |
tctgagtaatttggatactcatgcatgtcagaagtatggtgaataaac |
10663583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 10663782 - 10663718
Alignment:
| Q |
11 |
acatcatctcaaaatcaatcaatcaccttttggcatatacaagaagatgattagaaagagtggac |
75 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10663782 |
acatcatctcaaactcaatcaatcaccttttggcatttacaagaagatgattagaaagagtggac |
10663718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University