View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_48 (Length: 228)
Name: NF0238_low_48
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 50 - 172
Target Start/End: Complemental strand, 11028094 - 11027972
Alignment:
| Q |
50 |
aatgcaaatgttaataattaattgttagattaaataaagtggttcttattttattttttgggttcaatggaaataacttgttttactgccatccatgcca |
149 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11028094 |
aatgcaaatgttaatagttaattgttagattaaataaagtggttcttattttattttttgggttcaatggaaataacttgttttactgccatccatgcca |
11027995 |
T |
 |
| Q |
150 |
gttataattttagaaagtaccag |
172 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11027994 |
gttataattttagaaagtaccag |
11027972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 8293584 - 8293547
Alignment:
| Q |
167 |
taccagtttcaatcaattgtaagcagctccacaggttc |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8293584 |
taccagtttcagtcaattgtaagcagctccacaggttc |
8293547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University