View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_56 (Length: 212)
Name: NF0238_low_56
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0238_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 22 - 184
Target Start/End: Original strand, 44845289 - 44845451
Alignment:
| Q |
22 |
attctttctgtcttgcttatttcccttcaaagtttggtcaatcatcaactgactcaacccgaatccaaatgcggttgtgtctgtcgcgacaacagtacaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44845289 |
attctttctgtcttgcttatttcccttcaaagtttggtcaatcatcaactgactcaacccgaatccaaatgcggttgtgtctgtcgcgacaacagtacaa |
44845388 |
T |
 |
| Q |
122 |
catgtaacgattcagacaagttttgtggggttcagtattcggatcagactcaaatggcagcct |
184 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44845389 |
catgtaacgattcagacaagctttgtggggttcagtattcggatcagactcaaatggcagcct |
44845451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 174
Target Start/End: Original strand, 44858354 - 44858410
Alignment:
| Q |
118 |
acaacatgtaacgattcagacaagttttgtggggttcagtattcggatcagactcaa |
174 |
Q |
| |
|
||||||||||||||||| || ||| |||||||||| |||||||| |||||| |||| |
|
|
| T |
44858354 |
acaacatgtaacgattcggagaaggtttgtggggtccagtattctaatcagaatcaa |
44858410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University