View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0238_low_60 (Length: 208)

Name: NF0238_low_60
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0238_low_60
NF0238_low_60
[»] chr4 (2 HSPs)
chr4 (25-97)||(46931655-46931727)
chr4 (131-201)||(46931557-46931627)
[»] chr2 (1 HSPs)
chr2 (29-72)||(44510317-44510360)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 25 - 97
Target Start/End: Complemental strand, 46931727 - 46931655
Alignment:
25 aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46931727 aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca 46931655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 131 - 201
Target Start/End: Complemental strand, 46931627 - 46931557
Alignment:
131 atgatatgatatggttgaatatttgaaggaaaattctaaattccaactaattattatatttatgatgatgt 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
46931627 atgatatgatatggttgaatatttgaaggaaaattctaaattccaactaattattatatatatgatgatgt 46931557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 29 - 72
Target Start/End: Complemental strand, 44510360 - 44510317
Alignment:
29 tatcatcccaaaccaatcctgatgaaccttgtctcctgaatgat 72  Q
    ||||||||||||| || ||||||||||||||||| |||||||||    
44510360 tatcatcccaaacaaaccctgatgaaccttgtcttctgaatgat 44510317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1986 times since January 2019
Visitors: 2396