View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0238_low_64 (Length: 203)
Name: NF0238_low_64
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0238_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 1e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 99 - 171
Target Start/End: Complemental strand, 46931727 - 46931655
Alignment:
Q |
99 |
aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46931727 |
aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca |
46931655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 103 - 146
Target Start/End: Complemental strand, 44510360 - 44510317
Alignment:
Q |
103 |
tatcatcccaaaccaatcctgatgaaccttgtctcctgaatgat |
146 |
Q |
|
|
||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
T |
44510360 |
tatcatcccaaacaaaccctgatgaaccttgtcttctgaatgat |
44510317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University