View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0238_low_64 (Length: 203)

Name: NF0238_low_64
Description: NF0238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0238_low_64
NF0238_low_64
[»] chr4 (1 HSPs)
chr4 (99-171)||(46931655-46931727)
[»] chr2 (1 HSPs)
chr2 (103-146)||(44510317-44510360)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 1e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 99 - 171
Target Start/End: Complemental strand, 46931727 - 46931655
Alignment:
99 aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46931727 aatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagcca 46931655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 103 - 146
Target Start/End: Complemental strand, 44510360 - 44510317
Alignment:
103 tatcatcccaaaccaatcctgatgaaccttgtctcctgaatgat 146  Q
    ||||||||||||| || ||||||||||||||||| |||||||||    
44510360 tatcatcccaaacaaaccctgatgaaccttgtcttctgaatgat 44510317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University