View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0239_high_1 (Length: 263)
Name: NF0239_high_1
Description: NF0239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0239_high_1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 263
Target Start/End: Original strand, 39076895 - 39077128
Alignment:
| Q |
30 |
gatttgatccagagaaaagtgtttgatcatttgaagatgaattgtcttggaatgaatgaagagaaagaccaagatcctgtgttgagttgtttgttcttga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076895 |
gatttgatccagagaaaagtgtttgatcatttgaagctgaattgtcttggaatgaatgaagagaaagaccaagatcctgtgttgagttgtttgttcttga |
39076994 |
T |
|
| Q |
130 |
gattatatcagaagagtagctttgaaaattcatagattcaccaacagaagttgttggaaaaaatgctatagcatcattatcaatagttgattgaatgaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076995 |
gattatatcagaagagtagctttgaaaattcatagattcaccaacagaagttgttggaaaaaatgctatagcatcattatcaatagttgattgaatgaaa |
39077094 |
T |
|
| Q |
230 |
cctgaatggttatggttatgatgattgttctgct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39077095 |
cctgaatggttatggttatgatgattgttctgct |
39077128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1639 times since January 2019
Visitors: 2392