View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0239_low_1 (Length: 399)
Name: NF0239_low_1
Description: NF0239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0239_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 77 - 350
Target Start/End: Complemental strand, 12870182 - 12869914
Alignment:
| Q |
77 |
gcataggaaaaagtataaggaaaagcgttgcaaagcggtaaattgaaagccaaggctcacgcnnnnnnnntgtagcgacaccattccctattttcttctt |
176 |
Q |
| |
|
|||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12870182 |
gcataggaaaaagtcta-ggaaaagcgtcacaaagcggtaaattgaaagccaaggctcacgcaaaaaaaatgtagcgacaccattccctattttcttctt |
12870084 |
T |
 |
| Q |
177 |
tgcatattcaagaaaccaatctaggttcgactccctcactttatctatctaaatcacaaatatctttccgccataaagaaacaaacttgaccggccttgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12870083 |
tgcatattcaagaaaccaatctaggttcgactccctcactttatcta----aatcacaaatatctttccgccataaagaaacaaacttgaccggccttgt |
12869988 |
T |
 |
| Q |
277 |
tcgattaatgttaaccatagtaggctccccttccccatatttagattttaacaattccttcaatgttgctacat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12869987 |
tcgattaatgttaaccatagtaggctccccttccccatatttagattttaacaattccttcaatgttgctacat |
12869914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University