View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243-INSERTION-11 (Length: 100)
Name: NF0243-INSERTION-11
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243-INSERTION-11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 7e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 7 - 100
Target Start/End: Complemental strand, 42737693 - 42737600
Alignment:
| Q |
7 |
acttgttacctagtagtagcctgcttgcnnnnnnngactcaatatatacaacctagctagcttgctagatgaaaaaggttagaactttttaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42737693 |
acttgttacctagtagtagcctgcttgctttttttgactcaatatatacaacctagctagcttgctagatgaaaaaggttagaactttttaaag |
42737600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University