View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243-INSERTION-3 (Length: 129)
Name: NF0243-INSERTION-3
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243-INSERTION-3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 129
Target Start/End: Complemental strand, 42737693 - 42737571
Alignment:
| Q |
7 |
acttgttacctagtagtagcctgcttgcnnnnnnngactcaatatatacaacctagctagcttgctagatgaaaaaggttagaactttttaaagtattat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42737693 |
acttgttacctagtagtagcctgcttgctttttttgactcaatatatacaacctagctagcttgctagatgaaaaaggttagaactttttaaagtattat |
42737594 |
T |
 |
| Q |
107 |
ttggcacacaatatatgtatata |
129 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42737593 |
ttggcacacaatatatgtatata |
42737571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University