View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243-INSERTION-8 (Length: 329)
Name: NF0243-INSERTION-8
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243-INSERTION-8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 8 - 327
Target Start/End: Original strand, 25478152 - 25478470
Alignment:
Q |
8 |
gaattttcaatactagctgaaatcgtattgtattcctcacatggttgtatgcagtgactcatgcaatagagactgaattaatcttgattgcaacactccc |
107 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
25478152 |
gaattttcaataccagctgaaatcgtattgtattcctcacatggttacatgcagtgactcatgcaatagagactgatttaatcttgattgcaacactccc |
25478251 |
T |
 |
Q |
108 |
tgtggctgaaaaagtgtaagatttatatgttttggaaaaatttaactagtcttgcttgctgccttggtggaaactgaaacatatacatgcacactttcaa |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||| |
|
|
T |
25478252 |
tgtggctgaaaaagtgtaagatttatatgttttggaaaaatttaactagtcttgcttgttgccttggtgg-aactgaaacataaacatgcacactttcaa |
25478350 |
T |
 |
Q |
208 |
ggtatatatgaaactaagttcaaaaaagggtttatttctcaatacaaattgcaaaagaatagtaatcatgcatttgacaatagtgaaaagtaatgttttt |
307 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||| |
|
|
T |
25478351 |
ggtatatatgaaactaagttcaaaaaagggtttatttctcaatacaaattgcaaaagaatagtaatcatgcatttggcagtagtgagaagtaatgttttt |
25478450 |
T |
 |
Q |
308 |
aatataaaccctaaacctac |
327 |
Q |
|
|
||||||||| |||||||||| |
|
|
T |
25478451 |
aatataaactctaaacctac |
25478470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University