View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_21 (Length: 383)
Name: NF0243_high_21
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 7 - 354
Target Start/End: Complemental strand, 14201143 - 14200796
Alignment:
| Q |
7 |
tcgaataatatgatcgtactgcatcaccacaatcacagttaaagatcaaagccttcatttcaccaccaagatcttcaaacaaggcttctaaacctccgtt |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14201143 |
tcgaagaatatgatcgtactgcatcaccacaatcacagttaaagatcaaagccttcatttctccaccaagatcttcaaacaaggcttctaaacctccatt |
14201044 |
T |
 |
| Q |
107 |
accgtctctgtcaaaatcagcatctgtctcttcctcatcctctgcatcatcgacgtcatcttcatcatcttattgcagcgttaatggtggaggttccagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14201043 |
accgtctctgtcaaaatcagcatctgtctcttcctcatcctctgcatcatcgacgtcatcttcatcatcttattgcagcgttaatggtggaggttccagc |
14200944 |
T |
 |
| Q |
207 |
cagaagcacacgacagagcagcctgtagtttaccgatgcgttcatcatatgtcacaacagactgtcaatcatggaaacatggagagatcttctgggagga |
306 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14200943 |
cagaagtacacgacagagcagcctgtagtttaccgatgcgttcatcatatgtcacaacagactgtcaatcatggaaacatggagagatcttctgggagga |
14200844 |
T |
 |
| Q |
307 |
atgttcctctgccgcgcagcggttaccaatctcagaggaacactgatc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14200843 |
atgttcctctgccgcgcagcggttaccaatctcagaggaacactgatc |
14200796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University