View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_27 (Length: 350)
Name: NF0243_high_27
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 29 - 339
Target Start/End: Original strand, 49065127 - 49065437
Alignment:
| Q |
29 |
aacaatgattgtgatcttgggtgcaattcaaagtcaaatttagttacatgtttggacatagataattcttctaaaacatcctcagaaaatttcacttgtg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065127 |
aacaatgattgtgatcttgggtgcaattcaatgtcaaatttagttacatgtttggacatagataattcttctaaaacatcctcagaaaatttcacttgtg |
49065226 |
T |
|
| Q |
129 |
gctctgaatcaacttcagagccacgttttttcacttgcaactactgcaagagaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065227 |
gctctgaatcaacttcagagccacgttttttcacttgcaactactgcaagagaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaa |
49065326 |
T |
|
| Q |
229 |
gagagagaggtcaattgcaaaaagaggacggaggacgatgttctcagcaacaggaacaacctcatttcttcataatcatcttcaccaccgttatgcaaat |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065327 |
gagagagaggtcaattgcaaaaagaggacggaggacgatgttctcagcaacaggaacaacctcatttcttcataatcatcttcaccaccgttatgcaaat |
49065426 |
T |
|
| Q |
329 |
atggcatctct |
339 |
Q |
| |
|
||||||||||| |
|
|
| T |
49065427 |
atggcatctct |
49065437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 2867194 - 2867116
Alignment:
| Q |
179 |
agaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaagaggac |
257 |
Q |
| |
|
|||||||||| || ||||||||| | || ||||| |||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
2867194 |
agaaaattctatagctcacaagcattaggtggacaccaaaatgctcacaaaagagagagatcaatagcaaaaagaggac |
2867116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2519 times since January 2019
Visitors: 2401