View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_32 (Length: 333)
Name: NF0243_high_32
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 29 - 313
Target Start/End: Complemental strand, 23945544 - 23945261
Alignment:
Q |
29 |
aaagatgtcatgtccccacttttattcacattgctcaagcttttannnnnnnnccgaattatcaccgctagaactagcaacatgagttggtttcccatta |
128 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23945544 |
aaagatgtcatgtccccacttttattcacaccgctcaagcttttattttttg-ccgaattatcaccgctagaactagcaacatgagttggtttcccatta |
23945446 |
T |
 |
Q |
129 |
tttatgcctattttgcttgtaccaatatcacttctagttcnnnnnnnnnnnnnnnnncctactttaatgctagcattagaagagttaatttgggagggtt |
228 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
23945445 |
tttatgcctatttttcttgtaccaatatcacttctagttcttttttgtttattttttcgtactttaatgcttgcattagaagagttaatttgggagggtt |
23945346 |
T |
 |
Q |
229 |
tgtacccgctcctattttcatgcatatgatcgtatttttcagcattcaattcattaattcttttcttaagattttgagatgatgt |
313 |
Q |
|
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
23945345 |
tgtaaccgctccttatttcatgcatatgatcgtatttttcagcattcaattcattaattcttttcttaagattttgaaatgatgt |
23945261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University