View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_36 (Length: 315)
Name: NF0243_high_36
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 287
Target Start/End: Original strand, 40572643 - 40572920
Alignment:
| Q |
16 |
ctgacacgttaatactccgaagatcaagtttagtatgaaaaacaaggtaagtatatacgaaagtgtaggaaaatgaatcatatcatgaaggataaccatc |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||| |||||| || ||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
40572643 |
ctgacacgttaatattccgaagatcaagtttagtataaaaaacaagggaagtatgtatgaaagtgtaggaagatgaatcatatcatgagggataaccatc |
40572742 |
T |
|
| Q |
116 |
tccgtgttatccagatccgccccaaggcatgttctagtggagcaagacgtattgttgttgacgtggtctttcaggtaagttggtggatgtttttatccac |
215 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
40572743 |
tccgtgttatccaaatccgctccaaggcatgttctagtggagcaagacgtattgttgttgacgtggtctttcagataagtcagtggatgttttcatccac |
40572842 |
T |
|
| Q |
216 |
gtatcactgtaaaattgaccttttgatcggtccggaacaa------tctttcttttattacataaatttagtctttct |
287 |
Q |
| |
|
|| ||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40572843 |
gtgtcactgtgaaattgaccttttgattggtccggaacaaattcagtctttcttttattacataaatttagtctttct |
40572920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2855 times since January 2019
Visitors: 2404