View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0243_high_40 (Length: 299)

Name: NF0243_high_40
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0243_high_40
NF0243_high_40
[»] chr7 (2 HSPs)
chr7 (53-230)||(18464471-18464648)
chr7 (76-148)||(16189971-16190043)
[»] chr5 (1 HSPs)
chr5 (78-206)||(16601659-16601787)


Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 53 - 230
Target Start/End: Complemental strand, 18464648 - 18464471
Alignment:
53 agcagagattcggcgtgtcctggagattgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgctgcaggaggtctt 152  Q
    ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||    
18464648 agcagagattcggcgggtcctagagattgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgatgtaggaggtctt 18464549  T
153 gagattgaaagagcaatctctactttcaccaggttttttagggctcagaagcttggagaacttcgactgtgcatggtg 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18464548 gagattgaaagagcaatctctactttcaccaggttttttagggctcagaagcttggagaacttcgactgtgcatggtg 18464471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 148
Target Start/End: Complemental strand, 16190043 - 16189971
Alignment:
76 agattgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgctgcaggagg 148  Q
    ||||||||| ||||||||||   || |||||| |||||||| ||||| || | ||||||||||||| ||||||    
16190043 agattgcatatgctgctaaaaccgaagctgcagattacttcttgatgttgctagatgcttctgctgaaggagg 16189971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 78 - 206
Target Start/End: Complemental strand, 16601787 - 16601659
Alignment:
78 attgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgctgcaggaggtcttgagattgaaagagcaatctctactt 177  Q
    |||||||||||||||   |||||| |||||||||| ||| ||||||||||||||| ||| ||| || | ||| ||    ||||||||||  | ||||| |    
16601787 attgcatctgctgctggtgttgagtctgcaaattatttcttgatgatgttggatgtttcggctacaagtggttttctagttgaaagagctgtttctacct 16601688  T
178 tcaccaggttttttagggctcagaagctt 206  Q
    |||| || ||||||||| |||| ||||||    
16601687 tcacaagattttttaggactcaaaagctt 16601659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University