View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_47 (Length: 278)
Name: NF0243_high_47
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 30 - 183
Target Start/End: Original strand, 39691929 - 39692082
Alignment:
| Q |
30 |
aataatacatacaatattgaacggtaaaacaaaattattatatttttcactaaaatgaaacccnnnnnnnagggacactagaatgaacccgnnnnnnnnn |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
39691929 |
aataatacatacaatattgaacggtaaaacaaaattattatatttttcactaaaatgaaaccctttttttagggacactaaaatgaacccgttttttgtt |
39692028 |
T |
 |
| Q |
130 |
nnnggagtaactaaaatgaaacttattagtatgtgaatgagagagtataaatca |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39692029 |
tttggagtaactaaaatgaaacttattagtatgtgaatgagagagtataaatca |
39692082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 189 - 265
Target Start/End: Original strand, 39692659 - 39692735
Alignment:
| Q |
189 |
cttacagtgtattttggaccaataatatataagtggcccatggtgaaggtcctacttggcatttcatctggttgttc |
265 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39692659 |
cttacactgtattttggaccaataatatataagtggcccatggtgaaggtcctacttggcatttcatctggttgttc |
39692735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University