View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_57 (Length: 257)
Name: NF0243_high_57
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_high_57 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 27 - 257
Target Start/End: Complemental strand, 46905996 - 46905765
Alignment:
| Q |
27 |
tcacattgcacattgatctcacatcaatgccagctcactgtatggactaatttgcctgtgaaattcaggccatcttaggaacaaataattgcaactgtgt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46905996 |
tcacattgcacattgatctcacatcaatgccagctcactgtatggactaatttgcctgtgaaattcaggccatcttaggaacaaataattgcaactgtgt |
46905897 |
T |
|
| Q |
127 |
aggaattaattgatgacaaattagtctatgagatctatatcttataggcaaagtgagatcgacacggaggaatagcatatttagttagcatatcacatca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46905896 |
aggaattaattgatgacaaattagtctacgagatctatatcttataggcaaagtgagatcgacacggaggaatagcatatttagttagcatatcacatca |
46905797 |
T |
|
| Q |
227 |
aagtgtctagtggtaaaag-taacagaaatac |
257 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
46905796 |
aagtgtctagtggtaaaagttaacagaaatac |
46905765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2554 times since January 2019
Visitors: 2401