View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_60 (Length: 252)
Name: NF0243_high_60
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_high_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 23 - 239
Target Start/End: Complemental strand, 239675 - 239459
Alignment:
Q |
23 |
acatcatcaccctctttaacaagaaacgtcgttagagtggaacaacttattcagggattgcaccaatgcttggtgtgttggctcttcccacatttttctc |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
239675 |
acatcatcaccctctttaacaagaaacgtcgttagagtggaacaacttattcagggattgcaccaatgcttggtttgctggctcttcccacatttttctc |
239576 |
T |
 |
Q |
123 |
gtgtttcttgtgttccctacttctaaaccgatcttccaacacttgcatccatgttccactttttcgcaactcattcatttaacaagcaaatgttttgtct |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
239575 |
gtgtttcttgtgttccctacttctaaaccgatcttccaacacttgcatccatgttccactttttcgcaactcattcatctaacaagcaaatgttttgtct |
239476 |
T |
 |
Q |
223 |
tattcctatgttgttca |
239 |
Q |
|
|
||||||||||| ||||| |
|
|
T |
239475 |
tattcctatgtcgttca |
239459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2507 times since January 2019
Visitors: 2401