View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_67 (Length: 251)
Name: NF0243_high_67
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_high_67 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 9045882 - 9046009
Alignment:
| Q |
124 |
aactaatttgtcctgccttgaataagtgcttgacatgtgactccattgtacacttgaaaatcaatggaaatttttaattcttcctctcgacttctatgtg |
223 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
9045882 |
aactaatttgtcctaccttaaataagtgcttgacatgtgactccattgcacacttgaaaatcaatggaaaattttaattcttcctctccacttctatgtg |
9045981 |
T |
|
| Q |
224 |
gtaaaaggacaagcaacccgcatataaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9045982 |
gtaaaaggacaagcaacccgcatataaa |
9046009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 40 - 93
Target Start/End: Original strand, 9045817 - 9045870
Alignment:
| Q |
40 |
tggacatggtttgaatggacaccctctctcgtgtttccttttgggatgctttca |
93 |
Q |
| |
|
|||||||| |||||||||||| | | |||||| |||||| |||||||||||||| |
|
|
| T |
9045817 |
tggacatgatttgaatggacagcatatctcgtatttcctattgggatgctttca |
9045870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2312 times since January 2019
Visitors: 2400