View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_76 (Length: 241)
Name: NF0243_high_76
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_high_76 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 7814378 - 7814277
Alignment:
Q |
22 |
ttatgggattcaaggtgtggaaatccatatgaagattaatttcctcaacacgacgctgtttcgccgcttcaaaccatgcactgaagatgtgactatattg |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||| ||||||| |||| ||| |||||| ||| |
|
|
T |
7814378 |
ttatgggattcaaggtgtggaaatccatatgaagattaatttcctcaacactacgctgttttgcggcttcaatccatgcattgaatatgcgactatcttg |
7814279 |
T |
 |
Q |
122 |
ct |
123 |
Q |
|
|
|| |
|
|
T |
7814278 |
ct |
7814277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 111
Target Start/End: Complemental strand, 7860307 - 7860208
Alignment:
Q |
12 |
gagatgaaagttatgggattcaaggtgtggaaatccatatgaagattaatttcctcaacacgacgctgtttcgccgcttcaaaccatgcactgaagatgt |
111 |
Q |
|
|
||||||||| | ||||||||||| || ||||||| || || |||| | |||||||||| |||||||||| || ||||||| ||||||| ||||||||| |
|
|
T |
7860307 |
gagatgaaaataatgggattcaatgtttggaaatacagatttagatgtaattcctcaacatgacgctgttttgcggcttcaagccatgcattgaagatgt |
7860208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1929 times since January 2019
Visitors: 2394