View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_78 (Length: 226)
Name: NF0243_high_78
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_high_78 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 46 - 175
Target Start/End: Original strand, 6351924 - 6352053
Alignment:
| Q |
46 |
aagaatatacaaaggtgtatctaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga |
145 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6351924 |
aagaatatacaaaggtgtaactaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga |
6352023 |
T |
 |
| Q |
146 |
aagtggagtatgtaatcgatgtgatttacc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6352024 |
aagtggagtatgtaatcgatgtgatttacc |
6352053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University