View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_high_82 (Length: 206)
Name: NF0243_high_82
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_high_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 45113224 - 45113298
Alignment:
Q |
1 |
atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagtataat |
75 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
45113224 |
atgaatcttgacaattatcttagaccaataaataattttcttcctgatgtcaaagtgaaagtgttggagaataat |
45113298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 45124507 - 45124578
Alignment:
Q |
1 |
atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagtataat |
75 |
Q |
|
|
|||||||||||||||| | ||||||||| |||| || ||||| ||||||||||||||||||| |||| ||||| |
|
|
T |
45124507 |
atgaatcttgacaattgttttagaccaa---atgaattgcttccagatgtcaaagtgaaagtgtcggagaataat |
45124578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2597 times since January 2019
Visitors: 2402