View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_100 (Length: 238)
Name: NF0243_low_100
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_low_100 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 75 - 220
Target Start/End: Complemental strand, 32213332 - 32213187
Alignment:
Q |
75 |
agatgaacattcgatgaatcatgcctctagtccagttaaaagaaatttcatggttgcacaacatgcttctaaaagtttttgtattctaataataaaaacg |
174 |
Q |
|
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32213332 |
agatgaacatttgatgaatcatgcctctagcccagttaaaagaaatttcatggttgcacaacatgcttctaaaagtttttgtattctaataataaaaacg |
32213233 |
T |
 |
Q |
175 |
atttgtttggataaatgacataattatgaagctcttatatcataag |
220 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
32213232 |
atttgtttagataaatgacataattatgaagctcttatatcataag |
32213187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 81 - 171
Target Start/End: Complemental strand, 14160497 - 14160407
Alignment:
Q |
81 |
acattcgatgaatcatgcctctagtccagttaaaagaaatttcatggttgcacaacatgcttctaaaagtttttgtattctaataataaaa |
171 |
Q |
|
|
||||| || |||||| |||||||||||||||||| |||||||||||||||||||| || | ||||| | |||||||||||||||||||| |
|
|
T |
14160497 |
acatttgacgaatcacgcctctagtccagttaaaggaaatttcatggttgcacaatattttactaaatttgtttgtattctaataataaaa |
14160407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 81 - 165
Target Start/End: Original strand, 14161012 - 14161096
Alignment:
Q |
81 |
acattcgatgaatcatgcctctagtccagttaaaagaaatttcatggttgcacaacatgcttctaaaagtttttgtattctaata |
165 |
Q |
|
|
||||| || |||||||||||||| || ||||||| | |||||||||||||| ||| ||| ||||||||| ||||| ||||||||| |
|
|
T |
14161012 |
acatttgacgaatcatgcctctaatctagttaaaggtaatttcatggttgcgcaatatgattctaaaagattttgaattctaata |
14161096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 87 - 198
Target Start/End: Complemental strand, 32231180 - 32231068
Alignment:
Q |
87 |
gatgaatcatgcctctagtccagttaaaagaaatttcatggttgcacaacatgct-tctaaaagtttttgtattctaataataaaaacgatttgtttgga |
185 |
Q |
|
|
|||||||||||| | ||||| ||||||| ||||||||||||||||| || ||||| || ||| |||||||||| || |||||||||| | |||||||| |
|
|
T |
32231180 |
gatgaatcatgcttgtagtctagttaaaggaaatttcatggttgcataatatgctgtcaaaagttttttgtattatattaataaaaaccctctgtttgga |
32231081 |
T |
 |
Q |
186 |
taaatgacataat |
198 |
Q |
|
|
|||| ||||||| |
|
|
T |
32231080 |
taaacaacataat |
32231068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2097 times since January 2019
Visitors: 2396