View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0243_low_102 (Length: 226)

Name: NF0243_low_102
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0243_low_102
NF0243_low_102
[»] chr7 (1 HSPs)
chr7 (46-175)||(6351924-6352053)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 46 - 175
Target Start/End: Original strand, 6351924 - 6352053
Alignment:
46 aagaatatacaaaggtgtatctaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga 145  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6351924 aagaatatacaaaggtgtaactaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga 6352023  T
146 aagtggagtatgtaatcgatgtgatttacc 175  Q
    ||||||||||||||||||||||||||||||    
6352024 aagtggagtatgtaatcgatgtgatttacc 6352053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2712 times since January 2019
Visitors: 2402