View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0243_low_107 (Length: 206)

Name: NF0243_low_107
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0243_low_107
NF0243_low_107
[»] chr2 (2 HSPs)
chr2 (1-75)||(45113224-45113298)
chr2 (1-75)||(45124507-45124578)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 45113224 - 45113298
Alignment:
1 atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagtataat 75  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||    
45113224 atgaatcttgacaattatcttagaccaataaataattttcttcctgatgtcaaagtgaaagtgttggagaataat 45113298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 45124507 - 45124578
Alignment:
1 atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagtataat 75  Q
    |||||||||||||||| | |||||||||   |||| || ||||| ||||||||||||||||||| |||| |||||    
45124507 atgaatcttgacaattgttttagaccaa---atgaattgcttccagatgtcaaagtgaaagtgtcggagaataat 45124578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University