View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_21 (Length: 446)
Name: NF0243_low_21
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 405; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 16 - 436
Target Start/End: Complemental strand, 49305401 - 49304981
Alignment:
Q |
16 |
gatggacatcatcttatagtagtattttgtttaacgggcaagattgatgtacaatgtctatttttatttttgaacattgatgtcgttgtgtgtggttttc |
115 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
49305401 |
gatggaaatcatcttatagtagtattttgtttaacgggcaagattgatgtacaatgtctatttttatttttgaacattgatgtcgttgtgtgtagttttc |
49305302 |
T |
 |
Q |
116 |
ttgtatctgcaaagtattggtcttaatgatcatattccagagattaatttggttggttaatgctttgtttttcctttgcagcaatatattcacacccttg |
215 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
49305301 |
ttgtatgtgcaaagtattggtcttaatgatcatattccagagattaatttggttggttaatgctttgtttttcttttgcagcaatatattcacacccttg |
49305202 |
T |
 |
Q |
216 |
aggcctcgctccaggaggaaatgtcacgacatgccccattatatggtgctggtctggaggctctatcaatgaaagagttggaaacaatatctcgtattca |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49305201 |
aggcctcgctccaggaggaaatgtcacgacatgccccattatatggtgctggtctggaggctctatcaatgaaagagttggaaacaatatctcgtattca |
49305102 |
T |
 |
Q |
316 |
tgaagagggcctaaggcagatccatgcccttcaacaacgaaaagggagtccagcagggagtcctctcttgagtcctcatgctctccctcacagccatgga |
415 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49305101 |
tgaagagggcctaaggcagatccatgcccttcaacaacgaaaagggagtccagcagggagtcctctcttgagtcctcatgctctccctcacagccatgga |
49305002 |
T |
 |
Q |
416 |
ttatatcctgcagggtctgtg |
436 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
49305001 |
ttatatcctgcagggtctgtg |
49304981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University