View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_29 (Length: 409)
Name: NF0243_low_29
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 29 - 252
Target Start/End: Original strand, 9719658 - 9719881
Alignment:
| Q |
29 |
attttttaccgctcaattttgaatagacgttgcggaattggtaaaagcgggggtccccaccgccgcttttagttggagtaaggagacctgaccttggtgg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9719658 |
attttttaccgctcaattttgaatagacgttgcggatttggtaaaagcggcggtccccaccgtcgcttttagttggagtaaggagacctgacctgggtgg |
9719757 |
T |
|
| Q |
129 |
tcttgaaatttaaatttaacccacttgggattgtctggtgctgttagtttgagactttggagtaccgtcttttcaaagtctcaggatggattcactctgg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| ||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
9719758 |
tcttgaaatttaaatttaacccacttgggttagtctggtggtgttaatttgagactttggagtaaggtcttttcaaagtctcaggatcgattcactctgg |
9719857 |
T |
|
| Q |
229 |
tgccaatttctgtgggttagtttg |
252 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9719858 |
tgccaatttctgtgggttagtttg |
9719881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 279 - 401
Target Start/End: Original strand, 9719909 - 9720031
Alignment:
| Q |
279 |
gtttagttgaatgtgtctaataaggtgaacgcaatattttattttatttttaattagtgaagtgttgagaagtggataattgcatgtgtgaatctgagtc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9719909 |
gtttagttgaatgtgtctaataaggtgaacgcaatattttattttatttttaattagtgaagtgttgagaagtggataattgcatgcgtgaatctgagtc |
9720008 |
T |
|
| Q |
379 |
tcaagatatcaaatgtctctgct |
401 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9720009 |
tcaagatatcaaatgtctctgct |
9720031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1885 times since January 2019
Visitors: 2394