View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_41 (Length: 346)
Name: NF0243_low_41
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_41 |
 | |
|
| [»] scaffold0223 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0223 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 11 - 317
Target Start/End: Complemental strand, 21667 - 21349
Alignment:
| Q |
11 |
catagggcataaggtattatcagtgacatgttaaggaatttgcagactcttcctttgtcaagtccctttctctcgatattttcaacctttcacaatcatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21667 |
catagggcataaggtattatcagtgacatgttaaggaatttgcagactcttcctttgtcaagtccctttctctcgatattttcaacctttcacaatcatg |
21568 |
T |
|
| Q |
111 |
attctgttttcttcttctattacttttcatactcttatatatgaagcaaagtagaatcttatagaaagagtgtttt------------gaggaccctttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21567 |
attctgttttcttcttctattacttttcatactcttatatatgaagcaaagtagaatcttatagaaagagtgttttgagggtttttttgaggaccctttt |
21468 |
T |
|
| Q |
199 |
ggatttgaaagaatgagtagttgtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatggacacctgaacttcatcgtt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467 |
ggatttgaaagaatgagtagttgtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatggacacctgaacttcatcgtt |
21368 |
T |
|
| Q |
299 |
gctttgtttatgccattga |
317 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21367 |
gctttgtttatgccattga |
21349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 4e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 221 - 301
Target Start/End: Complemental strand, 25080630 - 25080550
Alignment:
| Q |
221 |
gtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatggacacctgaacttcatcgttgct |
301 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
25080630 |
gtggaagggaaggtgtggcgagacaatatgtaagaccaaaggttccttgtttaagatggacacatgaacttcatcgttgct |
25080550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 221 - 301
Target Start/End: Complemental strand, 25138599 - 25138519
Alignment:
| Q |
221 |
gtggaagggaaggtgttgtgagacaatatgtaagatcaaaggttcctcgtttaagatggacacctgaacttcatcgttgct |
301 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
25138599 |
gtggaagggaaggtgtggcgagacaatatgtaagaccaaaggttccttgtttaagatggacacatgaacttcatcgttgct |
25138519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 238 - 311
Target Start/End: Complemental strand, 50872837 - 50872764
Alignment:
| Q |
238 |
gtgagacaatatgtaagatcaaaggttcctcgtttaagatggacacctgaacttcatcgttgctttgtttatgc |
311 |
Q |
| |
|
||||| || ||| |||||||||| || |||||||| |||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
50872837 |
gtgaggcagtatataagatcaaaagtccctcgtttgagatggactcctgaacttcatcgttgctttgttcatgc |
50872764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1758 times since January 2019
Visitors: 2393