View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_47 (Length: 331)
Name: NF0243_low_47
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 157 - 250
Target Start/End: Original strand, 30336717 - 30336813
Alignment:
| Q |
157 |
aataaaatgcatatgcagccacatagtggaataaaatacatt-----gtttgtggttttgttctttctccatgcacctccacccgtcctcccttcaata |
250 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30336717 |
aataaaatgcat--gcagccacatagtggaataaaatacattatattgtttgtggttttgttctttctccatgcacctccacctgtcctcccttcaata |
30336813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 102 - 140
Target Start/End: Original strand, 30336684 - 30336722
Alignment:
| Q |
102 |
attattacattaacattctcctggcttaatgtaaataaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30336684 |
attattacattaacattctcctggcttaatgtaaataaa |
30336722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2658 times since January 2019
Visitors: 2402