View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_48 (Length: 321)
Name: NF0243_low_48
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_48 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 100 - 176
Target Start/End: Original strand, 17263076 - 17263152
Alignment:
| Q |
100 |
gtttcatctcccctgcagcaaaaaacacaatttgaagcatgttcatgtgcactttattttatttatttccttgtcca |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
17263076 |
gtttcatctcccctgcagcaaaaaacacaatttgaagcatgttcatgtgcactttgttttatttatttccttttcca |
17263152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2245 times since January 2019
Visitors: 2400