View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0243_low_48 (Length: 321)

Name: NF0243_low_48
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0243_low_48
NF0243_low_48
[»] chr6 (1 HSPs)
chr6 (100-176)||(17263076-17263152)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 100 - 176
Target Start/End: Original strand, 17263076 - 17263152
Alignment:
100 gtttcatctcccctgcagcaaaaaacacaatttgaagcatgttcatgtgcactttattttatttatttccttgtcca 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
17263076 gtttcatctcccctgcagcaaaaaacacaatttgaagcatgttcatgtgcactttgttttatttatttccttttcca 17263152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University