View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_60 (Length: 289)
Name: NF0243_low_60
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_60 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 80 - 283
Target Start/End: Complemental strand, 52285840 - 52285638
Alignment:
| Q |
80 |
atattacaatatcttctgaaaggataaacttcaatttggaacacaaatgacaaaaattagctaatataagggagacaagtttccataaataaatctacta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52285840 |
atattacaatatcttctgaaaggataaacttcaatttggaaca--aatgacaaaaattagctaatataagggagacaagtttccataaataaatctacta |
52285743 |
T |
|
| Q |
180 |
a-tgcaaattcagctatgtgtttaaatggtggcaaacaagaaaaagagaaccagtcttctcatgtaatgtgctatggaattataattgcttacctgtcaa |
278 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52285742 |
aatgcaaattcagctatgtgtttaaatggtggcaaacaagaaaaagagaaccagtcttttcatgtaatgtgatatggaattataattgcttacctgtcaa |
52285643 |
T |
|
| Q |
279 |
gtatg |
283 |
Q |
| |
|
||||| |
|
|
| T |
52285642 |
gtatg |
52285638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1984 times since January 2019
Visitors: 2396