View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_65 (Length: 282)
Name: NF0243_low_65
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 6036441 - 6036693
Alignment:
Q |
1 |
taggtaggaaggtttaggacagtatggtttgaggttatatacacattctgttcaacaattgcgcaattagtgtaacaaaatctattaccaatcctatttg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6036441 |
taggtaggaaggtttaggacagtatggtttgaggttatatacacattctgttcaacaattgcgcaattagtgtaacaaaatctattaccaatcctatttg |
6036540 |
T |
 |
Q |
101 |
gactcgatttaaattataattagaaatttttcattcacattcaaacaaatgttccaaagcggggtagctcatgatatagactatctttggatgatgtcgc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6036541 |
gactcgatttaaattataattagaaatttttcattcacattcaaacaaatgttccaaagcggggtagctcatgatatagactatctttggatgatgtcgc |
6036640 |
T |
 |
Q |
201 |
catcagatggaacatcttgtttagctgctgggacacgaaaagttagataattc |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
6036641 |
catcagatggaacatcttgtttagctgctgggacacgaaaagttggataattc |
6036693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1977 times since January 2019
Visitors: 2396