View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_69 (Length: 273)
Name: NF0243_low_69
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0243_low_69 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 114 - 273
Target Start/End: Original strand, 47699234 - 47699394
Alignment:
| Q |
114 |
taaattgaactaaaatgattt--aaatgtttatacttcgagtgatcctgaagcctacgtggttttcatgaaaccttgttcaacagttttccatcaagttc |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
47699234 |
taaattgaactaaaatgatttttaaatgtttatacgtcgagtgatcttgaagcctacgtggttttcaagaaaccttgttctacagttttccatcaagttc |
47699333 |
T |
|
| Q |
212 |
ggttgtggtttttcttcgaatttggagtttttcacataaaattcttgtgcggttattgtgtc |
273 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47699334 |
ggttgtgg-ttttctttgaatttggagtttttcacttaaaattcttgtgcggttattgtgtc |
47699394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 47699145 - 47699235
Alignment:
| Q |
1 |
tcatcagtggtaccaagttgtacattctctgacaatgctcagaagttagaat-------aattgttacttccaaattcttgttcgtttata |
84 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
47699145 |
tcatcagtggtaccaagttctacattatctgacaatgcttagaagttagaattcatgtaaattgttacttccgaattcttgttcgtttata |
47699235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2323 times since January 2019
Visitors: 2400