View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0243_low_70 (Length: 267)
Name: NF0243_low_70
Description: NF0243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0243_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 55 - 237
Target Start/End: Complemental strand, 20680107 - 20679929
Alignment:
Q |
55 |
ttattataatacgtttaagaaaaaccatagagatgataagggcttgatgtgcaaacgtcatgtgattgttttccactatgcttctgttgtgaaagtacat |
154 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20680107 |
ttattgtaatacgtttaagaaaaaccatagagatgataagggtttgatgtgcaaacgtcatgtgattgttttccactatgcttctgttgtgaaagtacat |
20680008 |
T |
 |
Q |
155 |
agttctaggat-agttagttggtttgttttgttttagttgtttcactacttttccgttaaatactgcgtgcgttagagcgggtt |
237 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20680007 |
agttctaggataagttagttgg-----tttgttttagttgtttcactacttttccgttaaatactgcgtgcgttagagcgggtt |
20679929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University